On this page you will find lab protocols for one-pot, one-step Type IIS mediated cloning reactions that will assemble multiple parts in a single step. If you require background information, please try our online video course.

Experienced users can download CHEAT SHEETS 1 and 2. (NOTE — These PDFs are designed to be printed on A3 paper, landscape, fitted to page)

This protocol assumes that:

(a) All modules being assembled have been “domesticated” (are free of internal BsaI and BpiI recognition sequences)
(b) That the junctions of all modules/parts/sequences being assembled have a unique set of compatible overhangs
(c) Your acceptor plasmid has a different antibiotic resistant to all of the modules being assembled into it

The assembly reactions must take place in a buffer that includes ATP, which is required for the T4 ligase to work. The reaction can be performed either in the restriction buffer with ATP added or in the ligase buffer (NEB’s ligase buffer contains ATP).  The  restriction buffer protocol is  shorter and works sufficiently well for almost all assemblies. However, we find that the longer ligase buffer protocol is sometimes more successful, especially for large assemblies (e.g level 2/M/P). Buffers containing ATP should not be subjected to multiple ‘freeze-thaw cycles’ – it is best to aliquot ATP and ATP-containing buffers on receipt. 

To assemble fragments in Level 0, Level 2 and Level M acceptors BpiI is required.

Add the following to a PCR tube,  make the reaction volume up to 20 μl with sterile distilled water and cycle as shown below:

To assemble fragments in Level -1, Level 1 and Level P acceptors  BsaI is required.

Add the following to a PCR tube,  make the reaction volume up to 20 μl with sterile distilled water and cycle as shown below:

Use 5 μl of the one-pot digestion ligation reaction to transform electrocompetent E.coli cells.

Positive clones can be selected using LB agar with an antibiotic appropriate to the backbone of the acceptor vector. If your acceptor vector contained the lacZ cassette include IPTG (0.5mM) and X-gal (40 microgram ml-1) for blue-white selection. Select 3 -10 (white) colonies for restriction analysis and confirmation by sequencing.

We use the following primers for amplification/sequencing of new modules:

Level 0:

F(0015): CGTTATCCCCTGATTCTGTGGATAAC
R(0016): GTCTCATGAGCGGATACATATTTGAATG

Level 1 binaries:
F(0229): GAACCCTGTGGTTGGCATGCACATAC
R(0230):CTGGTGGCAGGATATATTGTGGTG